Application of Affinity Electrophoresis
An alternative to acid-gel electrophoresis for the analysis of tRNA aminoacylation in vivo
Abbreviations:
EtOAc, ethylacetate
Temed, N,N,N′,N′-Tetramethylethylenediamine
APB, N-acryloyl-3-aminophenylboronate
ABSTRACT
Aminoacyl-tRNA can be distinguished from uncharged tRNA through its resistance to periodate oxidation. Oxidized tRNA is resolved from non-oxidized tRNA directly by polyacrylamide gel electrophoresis using a copolymerized boronic acid derivative. The application of such an affinity electrophoretic fractionation, followed by Northern blotting, to the analysis of the state of tRNA aminoacylation of a specific isoacceptor in vivo has been demonstrated and is a method that offers advantages over acid-gel electrophoresis.
The state of aminoacylation of tRNA in the cell reflects the amino acid availability and is an indicator of the cell's response to stress. Acid gel electrophoresis has advanced to the standard procedure for the analysis of the state of tRNA aminoacylation in vivo. Since the adaptation of the original procedure of Ho and Kan by Varshney et al., [3] its implementation in a variety of investigations [4,5] has reinforced the need for a procedure that distinguishes between free and aminoacylated tRNA. T. Pan and colleagues [6] introduced a high throughput analysis of aminoacyl-tRNA based on periodate oxidation. This rejuvenation of the well-established method [7,8] is based on the fact that charged tRNA is resistant to periodate oxidation, whereas uncharged tRNAs bearing free 3'-ribose groups are not [9]. Neither the historic protocol (relying on the quantitative re-aminoacylation of the protected tRNA) nor the contemporary technique (involving the ligation of a fluorescently tagged RNA to the intact 3' terminus, followed by microarray analysis) distinguish between periodate oxidized and non-oxidized termini directly. ln the 1980's we introduced a boronate-containing affinity electrophoreticmatrix that could be used to analyse the nature of RNA termini [10,11] Although the method has been adopted for certain analyses [12-15] its potential in the area of aminoacylation remains to be explored. Here, I demonstrate that the electrophoretic resolution between periodate oxidized and non-oxidized tRNA can be used as an alternative to the direct analysis of aminoacylation by acid gel electrophoresis.
In vitro aminoacylation was examined using E.coli tRNA enriched in tRNA [16] and recombinant E.coli arginyl-tRNA synthetase [17] (see Supplementary material). Electrophoresis was performed in standard commercial 10x10x0.1 cm cassettes (Anamed, Germany) using a 5% polyacrylamide gel (C=5.4) containing 7 M urea and 5 mg/ml N-acryloyl-3-aminophenylboronate (APB) [11] (see Supplementary material) in 100 mM Tris-OAc, pH 9. Polymerization was initiated with 5μl/ml 10% ammonium persulfate and 0.7 μl/ml Temed. The gel was pre-run at 6 mA for 15 min with 100 mM Tris-OAc, pH 9 as the running buffer. Samples (100 ng tRNA per lane) were applied in 10 μl 50% formamide/bromophenol blue and electrophoresis continued at 6 mA and room temperature until the dye had reached the end of the gel (approx. 2 h). Staining with SybrGold (Life Technologies, Darmstadt, Germany) for 30 min was followed by image capture using a PharosFX Plus imager (Bio-Rad, Munich, Germany) and quantification with the QuantityOne software (BioRad, v. 4.6.3) (Fig. 1).
It is evident that the upper (aminoacylated) band, discernable in the control that had been preparatively aminoacylated, accumulates during the kinetic time course and is clearly resolved from the faster migrating, oxidized, species. This procedure offers an alternative sensitive assay to measure the incorporation of non-radioactive amino acids for tRNAs that are not substrates for the cytoplasmic nucleotidyl transferase in the [32P]-AMP 3' terminal replacement procedure , such as metazoan mitochondrial tRNAs [19] or terminally modified tRNAs.
The utility of this method for the analysis of tRNAs aminoacylated in vivo was examined using jack bean leaves that had been frozen in liquid nitrogen after harvest and stored at -20°C for one year. To analyse the state of tRNA aminoacylation, Northern blotting of samples that had been electrophoretically fractionated in the absence and in the presence of APB was undertaken (see Supplementary material) (Fig. 2).
As shown previously [10] Fig. 2a confirms that in the absence of APB, electrophoresis cannot resolve oxidized from non-oxidized tRNA so that the state of aminoacylation of a specific isoacceptor is not distinguishable by Northern blotting. In contrast, in the presence of APB, (Fig. 2b) retardation by the matrix of 3'-terminally intact ribose of the band corresponding to the well-separated small ribosomal RNAs is a confirmation of the efficiency of the boronate interaction in the stained gel. Furthermore, the Northern blot using a probe targeted to the 3' end of jack bean tRNA reveals a clear distinction between aminoacylated (Fig. 2b, upper band) and uncharged forms (Fig. 2b, lower band) of the tRNA isoacceptor in vivo.
In performing such an analysis, one should be aware of a number of technical details:
-
The charge introduced into the gel by the boronate has number of consequences, including a slower migration of nucleic acids. Pre-electrophoresis of the APB gel should be minimized.
-
At the recommended 6 mA applied current, the bands retain an acceptable shape. Faster runs exacerbate of the intra-lane smiling effect.
-
The formation of the boronate-ribose complex is pH dependent [10]. I recommend the use of a pH 9.0 buffer (that must not contain borate). Should a high pH be detrimental to the sample, the pH can be reduced with a concomitant substantial increase in the amount of APB [15].
-
RNA can be visualized using Stains-All (Serva, Heidelberg, Germany), silver [20], or SybrGold (Life Technologies, Darmstadt, Germany). Ethidium bromide is not suitable since APB absorbs strongly in the UV region.
-
The co-precipitant when using small amounts of RNA should be linear polyacrylamide since commercial glycogen often contains material reacting with RNA stains [21]
A time course measurement of the oxidation has confirmed previous reports [22] that the reaction is complete within 2 min at a moderate molar excess of periodate. If a subsequent ethanol precipitation step is required the ethanol-insoluble iodate formed [23] can be reduced with 2-mercaptoethanol, as described (see Supplementary material) or by gel filtration or microdialysis. In view of low amounts of RNA involved - and hence the acceptable low quantity of periodate required - residual iodate may not interfere with the electrophoresis. However, one should appreciate that other components of the in vitro aminoacylation reaction or of material extracted from tissue will also consume periodate. Most obviously, ATP is a direct target but some amino acids are also attacked by periodate [24]. Furthermore, the major source of competing cis-diols is likely to be glycerol, which frequently accompanies enzyme preparations. This contributes high molar levels which need to be taken into account when periodate is added. Alternatively, glycerol may be removed by gel filtration prior to the assay.
In summary, acid-gel electrophoresis has been widely used but is technically challenging. The stability of the aminoacyl-ester bond, on which the method critically relies, is dependent on factors such as temperature, pH and the nature of the amino acid [25,26]. Low pH and temperature have a stabilizing effect, but repeated freeze-thawing leads to deacylation[2], limiting the lifetime of the sample. Furthermore, neutralization of the phosphate backbone at low pH together with cooling greatly reduces the electrophoretic migration rate of RNA. Yet, the importance of these parameters is reflected by the fact that electrophoresis buffer replacement every 6 h throughout the 25 h run is prescribed [27]. The resolution of the acid gel is dependent on the nature of the attached amino acid and the aminoacylation with large or basic amino acids may be detected on 70x90 mm gels [5]. However, even using 40 cm gels, the resolution of other aminoacylated tRNA can be minimal [28][29]. In contrast, the APB fractionation is complete within 2 h at room temperature, the clear resolution is independent of the nature amino acid and, after periodate treatment, samples can be stored for long periods and subsequent (re)analysis.
[1] J.M. Zaborske, J. Narasimhan, L. Jiang, S.A. Wek, K.A. Dittmar, F. Freimoser, et al, Genome-wide analysis of tRNA charging and activation of the eIF2 kinase Gcn2p, J. Biol. Chem. 284 (2009) 25254-67.
[2] Y.S. Ho, Y.W. Kan, In vivo aminoacylation of human and Xenopus suppressor tRNAs constructed by site-specific mutagenesis, Proc. Natl. Acad. Sci. U. S. A. 84 (1987) 2185-8.
[3] U. Varshney, C.P. Lee, U.L. RajBhandary, Direct analysis of aminoacylation levels of tRNAs in vivo. Application to studying recognition of Escherichia coli initiator tRNA mutants by glutaminyl-tRNA synthetase, J. Biol. Chem. 266 (1991) 24712-8.
[4] C. Köhrer, U.L. Rajbhandary, The many applications of acid urea polyacrylamide gel electrophoresis to studies of tRNAs and aminoacyl-tRNA synthetases, Methods. 44 (2008) 129-38.
[5] B.D. Janssen, E.J. Diner, C.S. Hayes, Analysis of aminoacyl- and peptidyl-tRNAs by gel electrophoresis, Methods Mol. Biol. 905 (2012) 291-309.
[6] K.A. Dittmar, M.A. Sørensen, J. Elf, M. Ehrenberg, T. Pan, Selective charging of tRNA isoacceptors induced by amino-acid starvation, EMBO Rep. 6 (2005) 151-7.
[7] D.W. Morris, J.A. DeMoss, Role of aminoacyl-transfer ribonucleic acid in the regulation of ribonucleic acid synthesis in Escherichia coli, J. Bacteriol. 90 (1965) 1624-31.
[8] C.D. Yegian, G.S. Stent, E.M. Martin, Intracellular condition of Escherichia coli transfer RNA, Proc. Natl. Acad. Sci. U. S. A. 55 (1966) 839-46.
[9] L.I. Hecht, M.L. Stephenson, P.C. Zamecnik, Binding of amino acids to the end group of a soluble ribonucleic acid, Proc. Natl. Acad. Sci. U. S. A. 45 (1959) 505-18.
[10] G.L. Igloi, H. Kössel, Affinity electrophoresis for monitoring terminal phosphorylation and the presence of queuosine in RNA. Application of polyacrylamide containing a covalently bound boronic acid, Nucl. Acids Res. 13 (1985) 6881-98.
[11] G.L. Igloi, H. Kössel, Use of boronate-containing gels for electrophoretic analysis of both ends of RNA molecules, Methods Enzymol. 155 (1987) 433-48.
[12] J.M. Lien, D.J. Petcu, C.E. Aldrich, W.S. Mason, Initiation and termination of duck hepatitis B virus DNA synthesis during virus maturation, J. Virol. 61 (1987) 3832-40.
[13] Förster, K. Chakraburtty, M. Sprinzl, Discrimination between initiation and elongation of protein biosynthesis in yeast: identity assured by a nucleotide modification in the initiator tRNA, Nucleic Acids Res. 21 (1993) 5679-83.
[14] P. DiMaria, B. Palic, B.A. Debrunner-Vossbrinck, J. Lapp, C.R. Vossbrinck, Characterization of the highly divergent U2 RNA homolog in the microsporidian Vairimorpha necatrix, Nucleic Acids Res. 24 (1996) 515-22.
[15] J.A. Matts, Y. Sytnikova, G.-W. Chirn, G.L. Igloi, N.C. Lau, Small RNA library construction from minute biological samples, Methods Mol. Biol. 1093 (2014) 123-36.
[16] J.-F. Wu, E.-D. Wang, Y.-L. Wang, E. Gilbert, G. Jean, Gene Cloning, Overproduction and Purification of Escherichia coli tRNA(Arg)(2), Acta Biochim. Biophys. Sin. 31 (1999) 226-32.
[17] C.A. Aldinger, A.-K. Leisinger, G.L. Igloi, The influence of identity elements on the aminoacylation of tRNA(Arg) by plant and E.coli arginyl-tRNA synthetases, FEBS J. 279 (2012) 3622-38.
[18] A.D. Wolfson, O.C. Uhlenbeck, Modulation of tRNAAla identity by inorganic pyrophosphatase, Proc. Natl Acad. Sci. USA. 99 (2002) 5965-70.
[19] A.-K. Leisinger, D.H. Janzen, W. Hallwachs, G.L. Igloi, Amino acid discrimination by the nuclear encoded mitochondrial arginyl-tRNA synthetase of the larva of a bruchid beetle (Caryedes brasiliensis) from northwestern Costa Rica, Insect Biochem. Mol. Biol. 43 (2013) 1172-80.
[20] G.L. Igloi, A silver stain for the detection of nanogram amounts of tRNA following two-dimensional electrophoresis, Anal. Biochem. 134 (1983) 184-8.
[21] A. Bartram, C. Poon, J. Neufeld, Nucleic acid contamination of glycogen used in nucleic acid precipitation and assessment of linear polyacrylamide as an alternative co-precipitant, Biotechniques. 47 (2009) 1019-22.
[22] F.S.H. Head, G. Hughes, The oxidation of simple organic substances by sodium metaperiodate in solutions exposed to daylight, J. Chem. Soc. (1952) 2046-52.
[23] A.A. Rizzino, M. Freundlich, Estimation of in vivo aminoacylation by periodate oxidation: tRNA alterations and iodate inhibition, Anal. Biochem. 66 (1975) 446-9.
[24] J.R. Clamp, L. Hough, The periodate oxidation of amino acids with reference to studies on glycoproteins, Biochem. J. 94 (1965) 17-24.
[25] F. Schuber, M. Pinck, On the chemical reactivity of aminoacyl-tRNA ester bond: 1-Influence of pH and nature of the acyl group on the rate of hydrolysis, Biochimie. 56 (1974) 383-90.
[26] F. Schuber, On the chemical reactivity of aminacyl-tRNA ester bond: III. Influence of ionic strength, spermidine and methanol on the rate of hydrolysis, Biochimie. 56 (1974) 397-403.
[27] W. Zhou, D. Karcher, R. Bock, Importance of adenosine-to-inosine editing adjacent to the anticodon in an Arabidopsis alanine tRNA under environmental stress, Nucl. Acids Res. (2013) 3362-72.
[28] I. Chernyakov, M.A. Baker, E.J. Grayhack, E.M. Phizicky, Chapter 11. Identification and analysis of tRNAs that are degraded in Saccharomyces cerevisiae due to lack of modifications, Methods Enzymol. 449 (2008) 221-37.
[29] A.J. Kemp, R. Betney, L. Ciandrini, A.C.M. Schwenger, M.C. Romano, I. Stansfield, A yeast tRNA mutant that causes pseudohyphal growth exhibits reduced rates of CAG codon translation, Mol. Microbiol. 87 (2013) 284-300.
Fig. 1
Time course of aminoacylation as determined by affinity electrophoresis. The experiment was conducted as described in the text. Aminoacylation control was performed at a preparative scale, at high enzyme concentration, in a separate incubation. The sample was applied to a non-adjacent lane of the same gel to prevent sample spill over. The full lengths of the lanes are shown. The inset shows the densitometric evaluation of the accumulation of non-oxidizable (aminoacylated) tRNA. The error bars refer to the reproducibility of gel resolution for the identical samples, stored at -20°C and run within 6 months of each other.
Fig. 2
In vivo tRNAArg aminoacylation in jack bean leaves as revealed by affinity electrophoresis. RNA (200 ng per lane) that had either been untreated (-) or had been subjected to periodate oxidation (+) (see Supplementary materials) was applied a 5% polyacrylamide gel containing 7M urea in the absence (a) or in the presence (b) of 5 mg/ml APB. The effect of oxidation is evident in (b) with a shift in the migration of bands corresponding to ribosomal RNAs (star). The overall migration rate difference between the gels is, in part, due to the increased total acrylamide concentration contributed by the APB. The full lengths of the lanes and blots are shown.
Supplementary Information
Synthesis of N-acryloyl-3-aminophenylboronic acid (APB).
Since the original publication, the protocol has been streamlined with minor modifications to improve the yield and quality of the product.
800 ml Water was deairated with stirring at 60°C for 15 min with a membrane vacuum pump and cooled to room temperature under vacuum. m-Aminophenylboronic acid hemisulfate (Sigma-Aldrich, Munich, Germany) (25 g; 0.134 mol) was dissolved in 540 ml deairated water and cooled to 0°C in ice. 22.6 g NaHCO3 was added in portions with stirring until frothing stopped. Any discoloured froth was scooped off with a spatula. The yellow solution was transferred to room temperature and, under rapid stirring; 19g (17 ml) acryloylchloride (Sigma-Aldrich, Munich, Germany or Merck, Darmstadt, Germany) was added dropwise from a separating funnel over a period of 40 min in a well-ventilated hood. Slow addition is critical for the final quality of the product. The fawn precipitate formed was left stirring at room temperature for 30 min and then cooled in ice for 2-3 h to give a mass of pale crystals. These were filtered off using a Buchner funnel and a membrane vacuum pump and washed with a small volume of ice-cold water. The filter cake was transferred to an 800 ml beaker in which it could be resuspended in 200-230 ml EtOAc and transfer to 500 ml conical flask. After dissolution giving a pale brown organic layer and a substantial amount of aqueous layer, an excess of anhydrous sodium sulfate was added until the entire aqueous layer was absorbed. This was left to complete the removal of the water overnight. The supernatant was decanted into a 1 L round bottom flask, the residual sodium sulfate dispersed with a spatula and washed with 50 ml of EtOAc. The EtOAc wash was filtered into the decanted supernatant and the combined EtOAc solution triturated with 600 ml n-hexane, shaking until the resulting oil solidified. The reaction mixture was stored at -20°C for 3-4 h and the clear supernatant decanted, ignoring any white crystals that may have escaped with the supernatant, leaving a fawn solid. Recrystallization was performed by dissolution in 200-300 ml water in 95°C water bath (supersaturation may occur with 200 ml) and filtration under vacuum into preheated flask. Crystallization occurred at 4°C over the course of several days and the product was recovered by filtration and drying in vacuum at 50°C over phosphorus pentoxide. The yield [MW (hemihydrate) = 200] was 13 -16 g (50-60%). APB is currently available from tRNA Probes (College Station, TX, USA)
In vitro aminoacylation
The assay at 37°C contained 4 µg tRNA, 50 mM Hepes-KOH, pH 7.5, 10 mM MgCl , 4 mM ATP, 1 mM L-Arg, 10 nM E.coli arginyl-tRNA synthetase in a 50µl volume. Before addition of the enzyme and at time intervals of 3, 6 and 15 min, a 10 µl aliquot was removed and mixed with 20 µl 1M NaOAc, pH 4.8 at 0°C. After completion, 20 µl 100 mM NaIO was mixed with each sample and incubated for 2 min at 0°C, followed by addition of 1M ethylene glycol and a further 2 min incubation at 0°C. In view of the intended recovery of the tRNA by ethanol precipitation, the alcohol insoluble NaIO product was reduced to NaI by the addition of 15 µl 1M 2-mercaptoethanol for 15 min at room temperature. After addition of 20 µg linear polyacrylamide, the tRNA was precipitated with 250 µl EtOH at -20°C, overnight. Following centrifugation, the tRNA was dissolved in 20 µl 10 mM Tris-OAc, pH 9 and the aminoacyl ester bond hydrolysed at 37°C for 30 min.
Analysis of aminoacylation in vivo
1g leaf tissue from jack bean (Canavalia ensiformis) plants was ground in liquid nitrogen to a fine powder. Of this, 0.3 g was transferred to a 2 ml reaction tube and resuspended in 1 ml cold 0.3M NaOAc pH 4.9, 10mM EDTA. Cold acidic phenol (Roth, Karlsruhe, Germany) (0.8 ml) was added and mixed for 2 min with cooling intervals. After a 5-min centrifugation at 20 000 xg 4°C, the upper phase was remove and added to fresh 0.5 ml phenol. Mixing and centrifugation was repeated and the upper phase transferred to two 2ml reaction tubes and ethanol precipitated at -20°C for 30 min. The nucleic acids were recovered by centrifugation, washed with 70% ethanol and dried briefly by draining. Each sample was resuspended in 200 µl cold 0.3 M NaOAc/1mM EDTA. One sample was treated with 200 µl 50 mM NaIO , and incubated at 0°C for 15 min in the dark. To the second tube 200 µl of cold water was added. Both samples were mixed with 100 µl 1M ethylene glycol and left for 15 min at 0°C in the dark. Ethanol precipitation overnight was followed by centrifugation and resuspension by shaking at 37°C for 2h in 200 µl 1M NaCl/0.1 M Tris-OAc, pH 9.0. A pale green suspension for the unoxidized control and a light brown suspension for the oxidized sample was obtained. Insoluble material was removed by centrifugation and both samples were desalted by gel filtration. Spectrophotometric assessment gave a yield of approx. 6 µg. Samples were stored at -20°C.
After electrophoresis of 200ng samples, using either a conventional 5% acrylamide/7M urea or an APB gel as described above, the gels were stained with SybrGold (Life Technologies, Darmstadt, Germany) and the fluorescent pattern recorded. Wet electro blotting to HybondN+ (GE Health Care) was carried out at 4°C and 250 mA in 0.5x TBE for 2 h (Trans-Blot, Bio-Rad, Munich, Germany) and the membrane fixed at 80°C for 2 h.
Prehybridization was in 0.1 % N-laurylsarcosine, 5x SSC, 0.02% SDS, 2µg/ml salmon sperm DNA and 1% Blocking reagent (Roche, Mannheim, Germany) for 2 h at 42°C. An oligonucleotide (TGGCGACTCCACTGGGGATCGA) (10 pmol) corresponding to the 3' end of jack bean tRNA was phosphorylated using 100µCi [32P] ATP and polynucleotide kinase and was hybridized to the membrane in the above buffer (without salmon sperm DNA) overnight at 42°C. After one wash with 6x SSC 0.1% SDS at 42°C for 15 min and two washes with 4x SSC 0.1% SDS at 42°C for 15 min and a final rinse at room temperature with 2xSSC 0.1% SDS for 15 min, the radioactive bands were detected by phosphorimaging.
[1]G.L. Igloi, H. Kössel, Affinity electrophoresis for monitoring terminal phosphorylation and the presence of queuosine in RNA. Application of polyacrylamide containing a covalently bound boronic acid., Nucl. Acids Res. 13 (1985) 6881-98.
[2]A.A. Rizzino, M. Freundlich, Estimation of in vivo aminoacylation by periodate oxidation: tRNA alterations and iodate inhibition., Anal. Biochem. 66 (1975) 446-9.
[3]G.L. Igloi, E. Schiefermayr, Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants., FEBS J. 276 (2009) 1307-18.

